Skip to main content

Table 1 Sequences of the specific primers used in Real-time PCR

From: Effects of maternal chlorpyrifos diet on social investigation and brain neuroendocrine markers in the offspring – a mouse study

Gene RefSeq accession   Sequence 5’ to 3’ Amplicon lenght
GAPDH NM_008084.2 fw ACCCAGAAGACTGTGGATGG 172 bp
   rev ACACATTGGGGGTAGGAACA  
ACTB NM_007393.3 fw TTGCTGACAGGATGCAGAAG 238 bp
   rev GAAAGGGTGTAAAACGCAGC  
OXT (Neurophysin I) NM_011025.4 fw CCCCAGTCTCGCTTGCTGCC 191 bp
   rev CGAAGCAGCCCAGCTCGTCC  
AVP (Neurophysin II) NM_009732.1 fw AGCCCGAGTGCCACGACGGT 146 bp
   rev GGGCTTGGCAGAATCCACGGAC  
OXTR NM_001081147.1 fw ACCATCCTGCTCGCCTGGGT 197 bp
   rev ATGCCCTCTGGGGCTCTCCG  
AVPR1a NM_016847.2 fw CCCTTGCCTCGGACAAGCCG 226 bp
   rev GTGGGAGCCTCGCGGGAAAC  
ESR1 (ERα) NM_007956.4 fw CTCAACCGCCCGCAGCTCAA 223 bp
   rev CCCCCAGGCTGTTGGCACTG  
ESR2 (ERβ) NM_207707.1 fw ACCCTCACTGGCACGTTGCG 204 bp
   rev GGCTTGCGGTAGCCAAGGGG